Review



pcs2 7myc glut4 gfp  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc pcs2 7myc glut4 gfp
    Pcs2 7myc Glut4 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 85 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/EGFR-GFP+(Plasmid+%2332751)/pm41912478-69-9-12
    Average 94 stars, based on 85 article reviews
    pcs2 7myc glut4 gfp - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+ in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’-TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT-3’ and 5’- AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Article Title: Establishing an auxin-inducible GFP nanobody-based acute protein knockdown system to mimic hypomorphic mutations during early medaka embryogenesis.
    Article Snippet: Auxin solution was refreshed every 48 h. The resulting phenotypes were assessed by imaging every day until hatch under a stereomicroscope with the attached Nikon camera. .. Degron system plasmids and mRNAs synthesis The degron system mRNAs were synthesized from constructs (Daniel et al., 2018) cloned into pCS2+ plasmids. pCDNA5FRT/TO_HA-mAIDnanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713; http://n2t.net/addgene:117713; RRID:Addgene_117713) and pCS2+_Flagmyc-NES-Tir1 was also a gift from Joerg Mansfeld (Addgene plasmid # 117717; http://n2t.net/addgene:117717; RRID:Addgene_117717). ..

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+ in pCS2+ (a gift from Dr. Randall Moon, Addgene,# 16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’-TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT-3’ and 5’-AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP- GFP was cloned from a plasmid, XE124 XDsh delta DEP- GFP- CS2+in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High- Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’- TACC GCGG GCCC GGGA TCCA GCCA CCAT GGCG GAGA CT-3’ and 5’- AGCC TGCA CCTG AGGA GTGC TTAT TTGT ATAG TTCA TCCA TGCC ATGT GTAA TCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a Asai et al. eLife 2023;12:RP89948.

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’- TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT -3’ and 5’- AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC ’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Article Title: Establishing an auxin-inducible GFP nanobody-based acute protein knockdown system to mimic hypomorphic mutations during early medaka embryogenesis
    Article Snippet: Auxin solution was refreshed every 48 h. The resulting phenotypes were assessed by imaging every day until hatch under a stereomicroscope with the attached Nikon camera. .. The degron system mRNAs were synthesized from constructs ( ) cloned into pCS2+ plasmids. pCDNA5FRT/TO_HA-mAID-nanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713; http://n2t.net/addgene:117713 ; RRID:Addgene_117713) and pCS2+_Flag-myc-NES-Tir1 was also a gift from Joerg Mansfeld (Addgene plasmid # 117717; http://n2t.net/addgene:117717 ; RRID:Addgene_117717). ..

    Plasmid Preparation:

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+ in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’-TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT-3’ and 5’- AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Article Title: Tribbles1 is host protective during in vivo mycobacterial infection
    Article Snippet: .. The expression vector pCS2+ (Addgene) was digested using the same restriction enzyme pair and all digests were gel extracted using QIAquick Gel Extraction Kit (QIAGEN). .. Gel extracts of vector and trib digests were ligated into pCS2+ via overnight incubation at room temperature with T4 DNA ligase according to the manufacturer’s instructions (NEB).

    Article Title: Elongation of the nascent avian foregut requires coordination of intrinsic and extrinsic cell behaviors
    Article Snippet: .. Fusion protein DeAct-SpvB-EGFP (Addgene #89446) was subcloned to pCS2 (isolated from pCS2-3nls-EGFP plasmid, Addgene #165400). .. Linearized DeAct-SpvB-EGFP and pCS2-3nls-EGFP plasmids were used for in vitro transcription of mRNA utilizing SP6 RNA Polymerase (SP6 mMessage Mmachine in vitro transcription kit, Thermo Fisher, #AM1340) , followed by purification via LiCl precipitation ( ).

    Article Title: Establishing an auxin-inducible GFP nanobody-based acute protein knockdown system to mimic hypomorphic mutations during early medaka embryogenesis.
    Article Snippet: Auxin solution was refreshed every 48 h. The resulting phenotypes were assessed by imaging every day until hatch under a stereomicroscope with the attached Nikon camera. .. Degron system plasmids and mRNAs synthesis The degron system mRNAs were synthesized from constructs (Daniel et al., 2018) cloned into pCS2+ plasmids. pCDNA5FRT/TO_HA-mAIDnanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713; http://n2t.net/addgene:117713; RRID:Addgene_117713) and pCS2+_Flagmyc-NES-Tir1 was also a gift from Joerg Mansfeld (Addgene plasmid # 117717; http://n2t.net/addgene:117717; RRID:Addgene_117717). ..

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+ in pCS2+ (a gift from Dr. Randall Moon, Addgene,# 16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’-TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT-3’ and 5’-AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP- GFP was cloned from a plasmid, XE124 XDsh delta DEP- GFP- CS2+in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High- Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’- TACC GCGG GCCC GGGA TCCA GCCA CCAT GGCG GAGA CT-3’ and 5’- AGCC TGCA CCTG AGGA GTGC TTAT TTGT ATAG TTCA TCCA TGCC ATGT GTAA TCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a Asai et al. eLife 2023;12:RP89948.

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’- TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT -3’ and 5’- AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC ’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Article Title: Establishing an auxin-inducible GFP nanobody-based acute protein knockdown system to mimic hypomorphic mutations during early medaka embryogenesis
    Article Snippet: Auxin solution was refreshed every 48 h. The resulting phenotypes were assessed by imaging every day until hatch under a stereomicroscope with the attached Nikon camera. .. The degron system mRNAs were synthesized from constructs ( ) cloned into pCS2+ plasmids. pCDNA5FRT/TO_HA-mAID-nanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713; http://n2t.net/addgene:117713 ; RRID:Addgene_117713) and pCS2+_Flag-myc-NES-Tir1 was also a gift from Joerg Mansfeld (Addgene plasmid # 117717; http://n2t.net/addgene:117717 ; RRID:Addgene_117717). ..

    Polymerase Chain Reaction:

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+ in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’-TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT-3’ and 5’- AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+ in pCS2+ (a gift from Dr. Randall Moon, Addgene,# 16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’-TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT-3’ and 5’-AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP- GFP was cloned from a plasmid, XE124 XDsh delta DEP- GFP- CS2+in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High- Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’- TACC GCGG GCCC GGGA TCCA GCCA CCAT GGCG GAGA CT-3’ and 5’- AGCC TGCA CCTG AGGA GTGC TTAT TTGT ATAG TTCA TCCA TGCC ATGT GTAA TCC’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a Asai et al. eLife 2023;12:RP89948.

    Article Title: Coupling and uncoupling of midline morphogenesis and cell flow in amniote gastrulation
    Article Snippet: .. ΔDEP-GFP was cloned from a plasmid, XE124 XDsh delta DEP-GFP-CS2+in pCS2+ (a gift from Dr. Randall Moon, Addgene, #16785), by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs, M0491) with the following primers: 5’- TACCGCGGGCCCGGGATCCAGCCACCATGGCGGAGACT -3’ and 5’- AGCCTGCACCTGAGGAGTGCTTATTTGTATAGTTCATCCATGCCATGTGTAATCC ’. .. After PCR purification with QIAquick Gel Extraction Kit (Qiagen, #28704), the PCR product was inserted into a backbone vector, pCAG-GFP (a gift from Connie Cepko, Addgene, #1115) by using Gibson-assembly (New England Biolabs, E2611).

    Expressing:

    Article Title: Tribbles1 is host protective during in vivo mycobacterial infection
    Article Snippet: .. The expression vector pCS2+ (Addgene) was digested using the same restriction enzyme pair and all digests were gel extracted using QIAquick Gel Extraction Kit (QIAGEN). .. Gel extracts of vector and trib digests were ligated into pCS2+ via overnight incubation at room temperature with T4 DNA ligase according to the manufacturer’s instructions (NEB).

    Gel Extraction:

    Article Title: Tribbles1 is host protective during in vivo mycobacterial infection
    Article Snippet: .. The expression vector pCS2+ (Addgene) was digested using the same restriction enzyme pair and all digests were gel extracted using QIAquick Gel Extraction Kit (QIAGEN). .. Gel extracts of vector and trib digests were ligated into pCS2+ via overnight incubation at room temperature with T4 DNA ligase according to the manufacturer’s instructions (NEB).

    Isolation:

    Article Title: Elongation of the nascent avian foregut requires coordination of intrinsic and extrinsic cell behaviors
    Article Snippet: .. Fusion protein DeAct-SpvB-EGFP (Addgene #89446) was subcloned to pCS2 (isolated from pCS2-3nls-EGFP plasmid, Addgene #165400). .. Linearized DeAct-SpvB-EGFP and pCS2-3nls-EGFP plasmids were used for in vitro transcription of mRNA utilizing SP6 RNA Polymerase (SP6 mMessage Mmachine in vitro transcription kit, Thermo Fisher, #AM1340) , followed by purification via LiCl precipitation ( ).

    Synthesized:

    Article Title: Establishing an auxin-inducible GFP nanobody-based acute protein knockdown system to mimic hypomorphic mutations during early medaka embryogenesis.
    Article Snippet: Auxin solution was refreshed every 48 h. The resulting phenotypes were assessed by imaging every day until hatch under a stereomicroscope with the attached Nikon camera. .. Degron system plasmids and mRNAs synthesis The degron system mRNAs were synthesized from constructs (Daniel et al., 2018) cloned into pCS2+ plasmids. pCDNA5FRT/TO_HA-mAIDnanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713; http://n2t.net/addgene:117713; RRID:Addgene_117713) and pCS2+_Flagmyc-NES-Tir1 was also a gift from Joerg Mansfeld (Addgene plasmid # 117717; http://n2t.net/addgene:117717; RRID:Addgene_117717). ..

    Article Title: Establishing an auxin-inducible GFP nanobody-based acute protein knockdown system to mimic hypomorphic mutations during early medaka embryogenesis
    Article Snippet: Auxin solution was refreshed every 48 h. The resulting phenotypes were assessed by imaging every day until hatch under a stereomicroscope with the attached Nikon camera. .. The degron system mRNAs were synthesized from constructs ( ) cloned into pCS2+ plasmids. pCDNA5FRT/TO_HA-mAID-nanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713; http://n2t.net/addgene:117713 ; RRID:Addgene_117713) and pCS2+_Flag-myc-NES-Tir1 was also a gift from Joerg Mansfeld (Addgene plasmid # 117717; http://n2t.net/addgene:117717 ; RRID:Addgene_117717). ..

    Construct:

    Article Title: Establishing an auxin-inducible GFP nanobody-based acute protein knockdown system to mimic hypomorphic mutations during early medaka embryogenesis.
    Article Snippet: Auxin solution was refreshed every 48 h. The resulting phenotypes were assessed by imaging every day until hatch under a stereomicroscope with the attached Nikon camera. .. Degron system plasmids and mRNAs synthesis The degron system mRNAs were synthesized from constructs (Daniel et al., 2018) cloned into pCS2+ plasmids. pCDNA5FRT/TO_HA-mAIDnanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713; http://n2t.net/addgene:117713; RRID:Addgene_117713) and pCS2+_Flagmyc-NES-Tir1 was also a gift from Joerg Mansfeld (Addgene plasmid # 117717; http://n2t.net/addgene:117717; RRID:Addgene_117717). ..

    Article Title: Establishing an auxin-inducible GFP nanobody-based acute protein knockdown system to mimic hypomorphic mutations during early medaka embryogenesis
    Article Snippet: Auxin solution was refreshed every 48 h. The resulting phenotypes were assessed by imaging every day until hatch under a stereomicroscope with the attached Nikon camera. .. The degron system mRNAs were synthesized from constructs ( ) cloned into pCS2+ plasmids. pCDNA5FRT/TO_HA-mAID-nanobody was a gift from Joerg Mansfeld (Addgene plasmid # 117713; http://n2t.net/addgene:117713 ; RRID:Addgene_117713) and pCS2+_Flag-myc-NES-Tir1 was also a gift from Joerg Mansfeld (Addgene plasmid # 117717; http://n2t.net/addgene:117717 ; RRID:Addgene_117717). ..



    Similar Products

    pcs2 7myc glut4 gfp  (Addgene inc)
    94
    Addgene inc pcs2 7myc glut4 gfp
    Pcs2 7myc Glut4 Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/EGFR-GFP+(Plasmid+%2332751)/pm41912478-69-9-12
    Average 94 stars, based on 1 article reviews
    pcs2 7myc glut4 gfp - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    pcs2 ncas9n plasmid  (Addgene inc)
    95
    Addgene inc pcs2 ncas9n plasmid
    Pcs2 Ncas9n Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/pCS2-nCas9n+(Plasmid+%2347929)/pm41885168-272-12-14
    Average 95 stars, based on 1 article reviews
    pcs2 ncas9n plasmid - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    pcs2 cas9  (Addgene inc)
    93
    Addgene inc pcs2 cas9
    Pcs2 Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/pCS2-Cas9+(Plasmid+%2347322)/pm41872214-369-39-45
    Average 93 stars, based on 1 article reviews
    pcs2 cas9 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    pcs2 jrgeco1a  (Addgene inc)
    93
    Addgene inc pcs2 jrgeco1a
    Pcs2 Jrgeco1a, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/pGP-CMV-NES-jRGECO1a+(Plasmid+%2361563)/pmc12934307-42-0-8
    Average 93 stars, based on 1 article reviews
    pcs2 jrgeco1a - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    pcs2 gcamp6s  (Addgene inc)
    95
    Addgene inc pcs2 gcamp6s
    Screening animals for hemimosaicism (A) Stage 43 tadpoles anesthetized and lined up in a 60 mm Petri dish for screening. (B) <t>GCaMP6s</t> fluorescence in two stage 43 tadpoles. Bottom tadpole is an example of a “good” animal, showing bright fluorescence in both the eye and spinal cord. Top tadpole does not show noticeable fluorescence in any parts other than the stomach. The top tadpole would be safe to discard if the other side of the animal does not show good fluorescence as well. (C) Examples of GCaMP6s fluorescence in two more stage 43 tadpoles. Bottom tadpole shows good fluorescence in the eye and brain. In comparison, although parts of the head and the heart of the top tadpole are fluorescent, there is no noticeable fluorescence present in the central nervous system, making it less likely to be a good hemimosaic animal. (D) Example of a custom screening chamber for stage 44 and older animals. The impression of a tadpole is carved into a block of Sylgard elastomer. The shape and size of the impression should be adjusted to snugly fit a tadpole and a drop of medium and allow a cover slip to be placed over the tadpole without compressing it. (E) GCaMP6s fluorescence in a stage 48 tadpole, showing bilateral hemimosaic distribution of fluorescent protein. The left half of the animal shows bright green fluorescence in most regions, whereas the right half is only fluorescent in parts of the tectum. (F) Close-up image of tadpole in (E), focusing on the tectum. GCaMP fluorescence can be seen in the entire left tectal hemisphere, as well as the neuropil region of the right tectal hemisphere (white arrow). (G–I) Widefield images of a stage 45 GluN1 MO tadpole, adapted from Kesner et al. (G) Brightfield, (H) MO-lissamine fluorescence, (I) merged image.
    Pcs2 Gcamp6s, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/pGP-CMV-GCaMP6s+(Plasmid+%2340753)/pmc12934307-41-0-8
    Average 95 stars, based on 1 article reviews
    pcs2 gcamp6s - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier
    source plasmid pcs2 hyper7  (Addgene inc)
    93
    Addgene inc source plasmid pcs2 hyper7
    Screening animals for hemimosaicism (A) Stage 43 tadpoles anesthetized and lined up in a 60 mm Petri dish for screening. (B) <t>GCaMP6s</t> fluorescence in two stage 43 tadpoles. Bottom tadpole is an example of a “good” animal, showing bright fluorescence in both the eye and spinal cord. Top tadpole does not show noticeable fluorescence in any parts other than the stomach. The top tadpole would be safe to discard if the other side of the animal does not show good fluorescence as well. (C) Examples of GCaMP6s fluorescence in two more stage 43 tadpoles. Bottom tadpole shows good fluorescence in the eye and brain. In comparison, although parts of the head and the heart of the top tadpole are fluorescent, there is no noticeable fluorescence present in the central nervous system, making it less likely to be a good hemimosaic animal. (D) Example of a custom screening chamber for stage 44 and older animals. The impression of a tadpole is carved into a block of Sylgard elastomer. The shape and size of the impression should be adjusted to snugly fit a tadpole and a drop of medium and allow a cover slip to be placed over the tadpole without compressing it. (E) GCaMP6s fluorescence in a stage 48 tadpole, showing bilateral hemimosaic distribution of fluorescent protein. The left half of the animal shows bright green fluorescence in most regions, whereas the right half is only fluorescent in parts of the tectum. (F) Close-up image of tadpole in (E), focusing on the tectum. GCaMP fluorescence can be seen in the entire left tectal hemisphere, as well as the neuropil region of the right tectal hemisphere (white arrow). (G–I) Widefield images of a stage 45 GluN1 MO tadpole, adapted from Kesner et al. (G) Brightfield, (H) MO-lissamine fluorescence, (I) merged image.
    Source Plasmid Pcs2 Hyper7, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/pCS2%2BHyPer7+(Plasmid+%23136466)/pmc13047110-132-7-10
    Average 93 stars, based on 1 article reviews
    source plasmid pcs2 hyper7 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    hyper7 sequence  (Addgene inc)
    93
    Addgene inc hyper7 sequence
    Scheme of the generated expression vectors: (A) vectors encoding ND4opt with one of the MTS (cox8k/n, cox10, cox4, and DNAjc30); (B) vector encoding a genetically encoded hydrogen peroxide sensor <t>(HyPer7)</t> with MTS.
    Hyper7 Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/pCS2%2BHyPer7+(Plasmid+%23136466)/pmc13047110-132-1-10
    Average 93 stars, based on 1 article reviews
    hyper7 sequence - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    notch1 full length plasmid  (Addgene inc)
    93
    Addgene inc notch1 full length plasmid
    a , Scheme of SLAM-seq. WT or Rubcn −/− BMDMs were cultured with 100 μM s 4 U in the presence or absence of apoptotic Jurkat cells and incubated at 37 °C for 2 h. Apoptotic cells (ACs) were then washed off with warm complete medium. Cells were cultured for another 2 h in the presence of 100 μM s 4 U at 37 °C. Total RNA was extracted for library construction and sequencing. b , GSEA of IFN signaling and Notch signaling genes in WT and Rubcn −/− BMDMs upon efferocytosis. GO, Gene Ontology. c , Schematic of experimental design. Apoptotic Jurkat cells expressing tdT were injected i.p. into WT and Rubcn −/− mice. Then, 3 h later, peritoneal macrophages were isolated and subjected to FACS sorting tdT − or tdT + (gated on DAPI − CD45 + CD11b + F4/80 + ) for RNA-seq. d , GSEA of upregulated <t>Notch1</t> target genes in WT and Rubcn −/− peritoneal macrophages upon efferocytosis as in c . e , Western blot of nuclear N2ICD in WT, Rubcn −/− and Atg5 −/− BMDMs that had engulfed apoptotic HT115 cells or not. TATA-binding protein (TBP) and apoptotic peptidase-activating factor1 (APAF1) served as markers for nuclear and cytosolic fractions, respectively. f , Western blot of nuclear N2ICD in WT and Rubcn −/− BMDMs with or without 1 μM CytoD treatment for 3 h upon efferocytosis. g , Confocal microscopy imaging of WT and Rubcn −/− RAW264.7 cells expressing Notch1–mCherry–NLS reporter and TIM4. Cells were cultured with unconjugated (control) beads or beads conjugated with DLL1 ± biotinylated PS for 3 h before fixing and imaging. Activation of Notch1 receptor was quantified by the intensity of mCherry in the nucleus over the total for each cell (100 × nuclear/total). Control group: WT, n = 21; Rubcn − / − , n = 25. DLL1 group: WT, n = 33; Rubcn − / − , n = 20. DLL + PS group: WT, n = 28; Rubcn − / − , n = 52. Statistical analysis was conducted using a Student’s t -test. Scale bars, 10 μm. h , WT RAW264.7 cells expressing Notch1–mCherry–NLS reporter and TIM4 were cultured with the indicated beads for 3 h before fixing and imaging. For RAW264.7 cells incubated with a mixture of beads coupled with DLL1 plus PS (no color) and DLL1 alone (green), cells that had engulfed or were in close contact with both were quantified as described above. Control, n = 33; DLL1, n = 38; DLL1 + PS, n = 34; DLL1 + PS and DLL1, n = 30; DAPT, n = 28. Asterisks indicate engulfed beads. Data are the mean ± s.d. Dots represent single cells. Statistical analysis was conducted using a Student’s t -test. Scale bars, 10 μm. GSEA significance was calculated using one-sided permutation testing based on a preranked approach. Panels created in BioRender: a , Verbist, K. https://biorender.com/jsrbskx (2026); c , Verbist, K. https://bioRender.com/q7evtdr (2026).
    Notch1 Full Length Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/pCS2+Notch1+Full+Length-6MT+(Plasmid+%2341728)/pmc13043306-287-8-11
    Average 93 stars, based on 1 article reviews
    notch1 full length plasmid - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    noti linearized pcs2 ncas9n plasmid  (Addgene inc)
    95
    Addgene inc noti linearized pcs2 ncas9n plasmid
    a , Scheme of SLAM-seq. WT or Rubcn −/− BMDMs were cultured with 100 μM s 4 U in the presence or absence of apoptotic Jurkat cells and incubated at 37 °C for 2 h. Apoptotic cells (ACs) were then washed off with warm complete medium. Cells were cultured for another 2 h in the presence of 100 μM s 4 U at 37 °C. Total RNA was extracted for library construction and sequencing. b , GSEA of IFN signaling and Notch signaling genes in WT and Rubcn −/− BMDMs upon efferocytosis. GO, Gene Ontology. c , Schematic of experimental design. Apoptotic Jurkat cells expressing tdT were injected i.p. into WT and Rubcn −/− mice. Then, 3 h later, peritoneal macrophages were isolated and subjected to FACS sorting tdT − or tdT + (gated on DAPI − CD45 + CD11b + F4/80 + ) for RNA-seq. d , GSEA of upregulated <t>Notch1</t> target genes in WT and Rubcn −/− peritoneal macrophages upon efferocytosis as in c . e , Western blot of nuclear N2ICD in WT, Rubcn −/− and Atg5 −/− BMDMs that had engulfed apoptotic HT115 cells or not. TATA-binding protein (TBP) and apoptotic peptidase-activating factor1 (APAF1) served as markers for nuclear and cytosolic fractions, respectively. f , Western blot of nuclear N2ICD in WT and Rubcn −/− BMDMs with or without 1 μM CytoD treatment for 3 h upon efferocytosis. g , Confocal microscopy imaging of WT and Rubcn −/− RAW264.7 cells expressing Notch1–mCherry–NLS reporter and TIM4. Cells were cultured with unconjugated (control) beads or beads conjugated with DLL1 ± biotinylated PS for 3 h before fixing and imaging. Activation of Notch1 receptor was quantified by the intensity of mCherry in the nucleus over the total for each cell (100 × nuclear/total). Control group: WT, n = 21; Rubcn − / − , n = 25. DLL1 group: WT, n = 33; Rubcn − / − , n = 20. DLL + PS group: WT, n = 28; Rubcn − / − , n = 52. Statistical analysis was conducted using a Student’s t -test. Scale bars, 10 μm. h , WT RAW264.7 cells expressing Notch1–mCherry–NLS reporter and TIM4 were cultured with the indicated beads for 3 h before fixing and imaging. For RAW264.7 cells incubated with a mixture of beads coupled with DLL1 plus PS (no color) and DLL1 alone (green), cells that had engulfed or were in close contact with both were quantified as described above. Control, n = 33; DLL1, n = 38; DLL1 + PS, n = 34; DLL1 + PS and DLL1, n = 30; DAPT, n = 28. Asterisks indicate engulfed beads. Data are the mean ± s.d. Dots represent single cells. Statistical analysis was conducted using a Student’s t -test. Scale bars, 10 μm. GSEA significance was calculated using one-sided permutation testing based on a preranked approach. Panels created in BioRender: a , Verbist, K. https://biorender.com/jsrbskx (2026); c , Verbist, K. https://bioRender.com/q7evtdr (2026).
    Noti Linearized Pcs2 Ncas9n Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcs2+-membrane-mcherry/pCS2-nCas9n+(Plasmid+%2347929)/med_rxiv__64898__2026__02__27__26347078-290-17-20
    Average 95 stars, based on 1 article reviews
    noti linearized pcs2 ncas9n plasmid - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Screening animals for hemimosaicism (A) Stage 43 tadpoles anesthetized and lined up in a 60 mm Petri dish for screening. (B) GCaMP6s fluorescence in two stage 43 tadpoles. Bottom tadpole is an example of a “good” animal, showing bright fluorescence in both the eye and spinal cord. Top tadpole does not show noticeable fluorescence in any parts other than the stomach. The top tadpole would be safe to discard if the other side of the animal does not show good fluorescence as well. (C) Examples of GCaMP6s fluorescence in two more stage 43 tadpoles. Bottom tadpole shows good fluorescence in the eye and brain. In comparison, although parts of the head and the heart of the top tadpole are fluorescent, there is no noticeable fluorescence present in the central nervous system, making it less likely to be a good hemimosaic animal. (D) Example of a custom screening chamber for stage 44 and older animals. The impression of a tadpole is carved into a block of Sylgard elastomer. The shape and size of the impression should be adjusted to snugly fit a tadpole and a drop of medium and allow a cover slip to be placed over the tadpole without compressing it. (E) GCaMP6s fluorescence in a stage 48 tadpole, showing bilateral hemimosaic distribution of fluorescent protein. The left half of the animal shows bright green fluorescence in most regions, whereas the right half is only fluorescent in parts of the tectum. (F) Close-up image of tadpole in (E), focusing on the tectum. GCaMP fluorescence can be seen in the entire left tectal hemisphere, as well as the neuropil region of the right tectal hemisphere (white arrow). (G–I) Widefield images of a stage 45 GluN1 MO tadpole, adapted from Kesner et al. (G) Brightfield, (H) MO-lissamine fluorescence, (I) merged image.

    Journal: STAR Protocols

    Article Title: Protocol for blastomere injection to generate bilateral hemimosaic Xenopus tadpoles

    doi: 10.1016/j.xpro.2026.104387

    Figure Lengend Snippet: Screening animals for hemimosaicism (A) Stage 43 tadpoles anesthetized and lined up in a 60 mm Petri dish for screening. (B) GCaMP6s fluorescence in two stage 43 tadpoles. Bottom tadpole is an example of a “good” animal, showing bright fluorescence in both the eye and spinal cord. Top tadpole does not show noticeable fluorescence in any parts other than the stomach. The top tadpole would be safe to discard if the other side of the animal does not show good fluorescence as well. (C) Examples of GCaMP6s fluorescence in two more stage 43 tadpoles. Bottom tadpole shows good fluorescence in the eye and brain. In comparison, although parts of the head and the heart of the top tadpole are fluorescent, there is no noticeable fluorescence present in the central nervous system, making it less likely to be a good hemimosaic animal. (D) Example of a custom screening chamber for stage 44 and older animals. The impression of a tadpole is carved into a block of Sylgard elastomer. The shape and size of the impression should be adjusted to snugly fit a tadpole and a drop of medium and allow a cover slip to be placed over the tadpole without compressing it. (E) GCaMP6s fluorescence in a stage 48 tadpole, showing bilateral hemimosaic distribution of fluorescent protein. The left half of the animal shows bright green fluorescence in most regions, whereas the right half is only fluorescent in parts of the tectum. (F) Close-up image of tadpole in (E), focusing on the tectum. GCaMP fluorescence can be seen in the entire left tectal hemisphere, as well as the neuropil region of the right tectal hemisphere (white arrow). (G–I) Widefield images of a stage 45 GluN1 MO tadpole, adapted from Kesner et al. (G) Brightfield, (H) MO-lissamine fluorescence, (I) merged image.

    Article Snippet: pCS2+ GCaMP6s , Cut from pGP-CMV-GCaMP6s #40753 from Addgene , Plasmid# 40753, RRID: Addgene_40753.

    Techniques: Fluorescence, Comparison, Blocking Assay

    Example results (A) Two-photon optical section from a bilateral hemimosaic GCaMP6s animal. GCaMP florescence can be seen restricted to the left tectum and the neuropil region of the right tectum. (B) Two-photon optical section from the left tectal hemisphere of a bilateral hemimosaic GCaMP6s animal with GCaMP florescence in postsynaptic tectal neurons on the left side. Yellow box marks a region of interest (ROI) in the neuropil area. (C) Two-photon optical section from the right tectal hemisphere of the same animal as shown in (B), displaying GCaMP fluorescence in RGC axon terminals distributed in the neuropil area. Yellow box marks an ROI in the neuropil area. (D) Example visual stimulus-evoked tectal cell calcium response trace, averaged over the ROI marked in (B). Grey triangles under the trace mark timepoints when a stimulus was shown to the right eye (a luminance step from white to various shades of grey, displayed on a small LED screen positioned next to the eye. The colour of the triangles represents the intensity of the luminance step – darker colours represent larger luminance steps). (E) Example visual stimulus-evoked RGC axonal calcium response trace averaged over the ROI marked in (C). The visual stimulus is the same as in (D) but presented to the left eye. (F) Cell body spontaneous calcium activity recorded from a bilateral hemimosaic GCaMP6s tadpole (different animal from B-E). (Left) Two-photon optical section from the left tectal hemisphere. Color overlays: ROIs of spontaneously active tectal neurons, identified by Suite2P software. Each ROI contains the cell body of a single tectal neuron that showed spontaneous activity. (Right) Spontaneous calcium activity traces extracted by Suite2P, each trace corresponding to a different ROI in the left panel. (G) (Left) Same two-photon optical section as shown in (F), overlaid with ROIs generated from Suite2P based on responses to a repeated looming stimulus (dark circle on a bright background expanding from small to large, displayed on a small LED screen positioned next to the right eye). (Right) Stimulus-evoked response traces extracted by Suite2P, each trace corresponding to a different ROI in the left panel. Top orange ticks denote the onset times of stimulus presentations (once every 6 seconds). (H) Confocal immunofluorescent section of a bilateral hemimosaic GluN1-MO animal, adapted from Kesner et al. Left: MO-lissamine fluorescence (magenta); middle: immunofluorescence staining for GluN1 (green); right: merged image. (I) Widefield epifluorescence image of a GCaMP6s transgenic tadpole with hemimosaic expression of jRGECO from mRNA blastomere injection. Left: GCaMP fluorescence (green); middle: jRGECO fluorescence (red); right: merged image.

    Journal: STAR Protocols

    Article Title: Protocol for blastomere injection to generate bilateral hemimosaic Xenopus tadpoles

    doi: 10.1016/j.xpro.2026.104387

    Figure Lengend Snippet: Example results (A) Two-photon optical section from a bilateral hemimosaic GCaMP6s animal. GCaMP florescence can be seen restricted to the left tectum and the neuropil region of the right tectum. (B) Two-photon optical section from the left tectal hemisphere of a bilateral hemimosaic GCaMP6s animal with GCaMP florescence in postsynaptic tectal neurons on the left side. Yellow box marks a region of interest (ROI) in the neuropil area. (C) Two-photon optical section from the right tectal hemisphere of the same animal as shown in (B), displaying GCaMP fluorescence in RGC axon terminals distributed in the neuropil area. Yellow box marks an ROI in the neuropil area. (D) Example visual stimulus-evoked tectal cell calcium response trace, averaged over the ROI marked in (B). Grey triangles under the trace mark timepoints when a stimulus was shown to the right eye (a luminance step from white to various shades of grey, displayed on a small LED screen positioned next to the eye. The colour of the triangles represents the intensity of the luminance step – darker colours represent larger luminance steps). (E) Example visual stimulus-evoked RGC axonal calcium response trace averaged over the ROI marked in (C). The visual stimulus is the same as in (D) but presented to the left eye. (F) Cell body spontaneous calcium activity recorded from a bilateral hemimosaic GCaMP6s tadpole (different animal from B-E). (Left) Two-photon optical section from the left tectal hemisphere. Color overlays: ROIs of spontaneously active tectal neurons, identified by Suite2P software. Each ROI contains the cell body of a single tectal neuron that showed spontaneous activity. (Right) Spontaneous calcium activity traces extracted by Suite2P, each trace corresponding to a different ROI in the left panel. (G) (Left) Same two-photon optical section as shown in (F), overlaid with ROIs generated from Suite2P based on responses to a repeated looming stimulus (dark circle on a bright background expanding from small to large, displayed on a small LED screen positioned next to the right eye). (Right) Stimulus-evoked response traces extracted by Suite2P, each trace corresponding to a different ROI in the left panel. Top orange ticks denote the onset times of stimulus presentations (once every 6 seconds). (H) Confocal immunofluorescent section of a bilateral hemimosaic GluN1-MO animal, adapted from Kesner et al. Left: MO-lissamine fluorescence (magenta); middle: immunofluorescence staining for GluN1 (green); right: merged image. (I) Widefield epifluorescence image of a GCaMP6s transgenic tadpole with hemimosaic expression of jRGECO from mRNA blastomere injection. Left: GCaMP fluorescence (green); middle: jRGECO fluorescence (red); right: merged image.

    Article Snippet: pCS2+ GCaMP6s , Cut from pGP-CMV-GCaMP6s #40753 from Addgene , Plasmid# 40753, RRID: Addgene_40753.

    Techniques: Fluorescence, Activity Assay, Software, Generated, Immunofluorescence, Staining, Transgenic Assay, Expressing, Injection

    Scheme of the generated expression vectors: (A) vectors encoding ND4opt with one of the MTS (cox8k/n, cox10, cox4, and DNAjc30); (B) vector encoding a genetically encoded hydrogen peroxide sensor (HyPer7) with MTS.

    Journal: Frontiers in Bioengineering and Biotechnology

    Article Title: Optimized ND4 allotopic expression for gene therapy of Leber’s hereditary optic neuropathy

    doi: 10.3389/fbioe.2026.1765995

    Figure Lengend Snippet: Scheme of the generated expression vectors: (A) vectors encoding ND4opt with one of the MTS (cox8k/n, cox10, cox4, and DNAjc30); (B) vector encoding a genetically encoded hydrogen peroxide sensor (HyPer7) with MTS.

    Article Snippet: The HyPer7 sequence was amplified from the source plasmid pCS2+HyPer7 (Addgene, cat. 136466) using primers ( ) with HindIII restriction sites at 3′ and Bgl II at 5′.

    Techniques: Generated, Expressing, Plasmid Preparation

    Values of ROS, hydrogen peroxide, calcium ions, and ΔΨm levels in HEK-293 (HEK) and HEK-293 LHON (HEK(LHON)) cell lines. (A) DCF (ROS) fluorescence level in cells; (B) HyPer7 fluorescence level (hydrogen peroxide) in mitochondria; (C) Case12 fluorescence level (calcium ions) in mitochondria; (D) TMRE fluorescence level (ΔΨm) in cells; n = 4 biological replicates. Data are shown as means ± SD. In each panel, statistics were evaluated using the Mann–Whitney U test; * p < 0.05.

    Journal: Frontiers in Bioengineering and Biotechnology

    Article Title: Optimized ND4 allotopic expression for gene therapy of Leber’s hereditary optic neuropathy

    doi: 10.3389/fbioe.2026.1765995

    Figure Lengend Snippet: Values of ROS, hydrogen peroxide, calcium ions, and ΔΨm levels in HEK-293 (HEK) and HEK-293 LHON (HEK(LHON)) cell lines. (A) DCF (ROS) fluorescence level in cells; (B) HyPer7 fluorescence level (hydrogen peroxide) in mitochondria; (C) Case12 fluorescence level (calcium ions) in mitochondria; (D) TMRE fluorescence level (ΔΨm) in cells; n = 4 biological replicates. Data are shown as means ± SD. In each panel, statistics were evaluated using the Mann–Whitney U test; * p < 0.05.

    Article Snippet: The HyPer7 sequence was amplified from the source plasmid pCS2+HyPer7 (Addgene, cat. 136466) using primers ( ) with HindIII restriction sites at 3′ and Bgl II at 5′.

    Techniques: Fluorescence, MANN-WHITNEY

    Effects of delivery of the functionally active ND4opt gene with various MTS into HEK-293 (LHON) cells on the level of ROS, hydrogen peroxide, calcium ions, and ΔΨm; (A) DCF (ROS) fluorescence levels in cells after delivery of the ND4opt gene with different MTS using plasmid vectors; (B) DCF fluorescence level (ROS) in cells after delivery of the ND4opt gene with various MTS using AAV vectors; (C) HyPer7 fluorescence level (hydrogen peroxide) in mitochondria after delivery of the ND4opt gene with various MTS using plasmid vectors; (D) Case12 (calcium ion) fluorescence level in mitochondria after delivery of the ND4opt gene with various MTS using plasmid vectors; (E) TMRE (ΔΨm) fluorescence level in cells after delivery of the ND4opt gene with different MTS using plasmid vectors; n = 4 biological replicates. Data are shown as means ± SD. In each panel, statistics were evaluated using the Mann–Whitney U test, where each variant “+MTSx_ND4” was compared with “+MTS8k_ND4mut” or AAV_empty (for B ), and the effect of the variant on the figure (shown by *) is indicated only for the variant “+MTS8k_ND4”; * p < 0.05.

    Journal: Frontiers in Bioengineering and Biotechnology

    Article Title: Optimized ND4 allotopic expression for gene therapy of Leber’s hereditary optic neuropathy

    doi: 10.3389/fbioe.2026.1765995

    Figure Lengend Snippet: Effects of delivery of the functionally active ND4opt gene with various MTS into HEK-293 (LHON) cells on the level of ROS, hydrogen peroxide, calcium ions, and ΔΨm; (A) DCF (ROS) fluorescence levels in cells after delivery of the ND4opt gene with different MTS using plasmid vectors; (B) DCF fluorescence level (ROS) in cells after delivery of the ND4opt gene with various MTS using AAV vectors; (C) HyPer7 fluorescence level (hydrogen peroxide) in mitochondria after delivery of the ND4opt gene with various MTS using plasmid vectors; (D) Case12 (calcium ion) fluorescence level in mitochondria after delivery of the ND4opt gene with various MTS using plasmid vectors; (E) TMRE (ΔΨm) fluorescence level in cells after delivery of the ND4opt gene with different MTS using plasmid vectors; n = 4 biological replicates. Data are shown as means ± SD. In each panel, statistics were evaluated using the Mann–Whitney U test, where each variant “+MTSx_ND4” was compared with “+MTS8k_ND4mut” or AAV_empty (for B ), and the effect of the variant on the figure (shown by *) is indicated only for the variant “+MTS8k_ND4”; * p < 0.05.

    Article Snippet: The HyPer7 sequence was amplified from the source plasmid pCS2+HyPer7 (Addgene, cat. 136466) using primers ( ) with HindIII restriction sites at 3′ and Bgl II at 5′.

    Techniques: Fluorescence, Plasmid Preparation, MANN-WHITNEY, Variant Assay

    a , Scheme of SLAM-seq. WT or Rubcn −/− BMDMs were cultured with 100 μM s 4 U in the presence or absence of apoptotic Jurkat cells and incubated at 37 °C for 2 h. Apoptotic cells (ACs) were then washed off with warm complete medium. Cells were cultured for another 2 h in the presence of 100 μM s 4 U at 37 °C. Total RNA was extracted for library construction and sequencing. b , GSEA of IFN signaling and Notch signaling genes in WT and Rubcn −/− BMDMs upon efferocytosis. GO, Gene Ontology. c , Schematic of experimental design. Apoptotic Jurkat cells expressing tdT were injected i.p. into WT and Rubcn −/− mice. Then, 3 h later, peritoneal macrophages were isolated and subjected to FACS sorting tdT − or tdT + (gated on DAPI − CD45 + CD11b + F4/80 + ) for RNA-seq. d , GSEA of upregulated Notch1 target genes in WT and Rubcn −/− peritoneal macrophages upon efferocytosis as in c . e , Western blot of nuclear N2ICD in WT, Rubcn −/− and Atg5 −/− BMDMs that had engulfed apoptotic HT115 cells or not. TATA-binding protein (TBP) and apoptotic peptidase-activating factor1 (APAF1) served as markers for nuclear and cytosolic fractions, respectively. f , Western blot of nuclear N2ICD in WT and Rubcn −/− BMDMs with or without 1 μM CytoD treatment for 3 h upon efferocytosis. g , Confocal microscopy imaging of WT and Rubcn −/− RAW264.7 cells expressing Notch1–mCherry–NLS reporter and TIM4. Cells were cultured with unconjugated (control) beads or beads conjugated with DLL1 ± biotinylated PS for 3 h before fixing and imaging. Activation of Notch1 receptor was quantified by the intensity of mCherry in the nucleus over the total for each cell (100 × nuclear/total). Control group: WT, n = 21; Rubcn − / − , n = 25. DLL1 group: WT, n = 33; Rubcn − / − , n = 20. DLL + PS group: WT, n = 28; Rubcn − / − , n = 52. Statistical analysis was conducted using a Student’s t -test. Scale bars, 10 μm. h , WT RAW264.7 cells expressing Notch1–mCherry–NLS reporter and TIM4 were cultured with the indicated beads for 3 h before fixing and imaging. For RAW264.7 cells incubated with a mixture of beads coupled with DLL1 plus PS (no color) and DLL1 alone (green), cells that had engulfed or were in close contact with both were quantified as described above. Control, n = 33; DLL1, n = 38; DLL1 + PS, n = 34; DLL1 + PS and DLL1, n = 30; DAPT, n = 28. Asterisks indicate engulfed beads. Data are the mean ± s.d. Dots represent single cells. Statistical analysis was conducted using a Student’s t -test. Scale bars, 10 μm. GSEA significance was calculated using one-sided permutation testing based on a preranked approach. Panels created in BioRender: a , Verbist, K. https://biorender.com/jsrbskx (2026); c , Verbist, K. https://bioRender.com/q7evtdr (2026).

    Journal: Nature Immunology

    Article Title: Exclusion of Notch from the contact site during efferocytosis restricts anticancer immunity

    doi: 10.1038/s41590-026-02452-3

    Figure Lengend Snippet: a , Scheme of SLAM-seq. WT or Rubcn −/− BMDMs were cultured with 100 μM s 4 U in the presence or absence of apoptotic Jurkat cells and incubated at 37 °C for 2 h. Apoptotic cells (ACs) were then washed off with warm complete medium. Cells were cultured for another 2 h in the presence of 100 μM s 4 U at 37 °C. Total RNA was extracted for library construction and sequencing. b , GSEA of IFN signaling and Notch signaling genes in WT and Rubcn −/− BMDMs upon efferocytosis. GO, Gene Ontology. c , Schematic of experimental design. Apoptotic Jurkat cells expressing tdT were injected i.p. into WT and Rubcn −/− mice. Then, 3 h later, peritoneal macrophages were isolated and subjected to FACS sorting tdT − or tdT + (gated on DAPI − CD45 + CD11b + F4/80 + ) for RNA-seq. d , GSEA of upregulated Notch1 target genes in WT and Rubcn −/− peritoneal macrophages upon efferocytosis as in c . e , Western blot of nuclear N2ICD in WT, Rubcn −/− and Atg5 −/− BMDMs that had engulfed apoptotic HT115 cells or not. TATA-binding protein (TBP) and apoptotic peptidase-activating factor1 (APAF1) served as markers for nuclear and cytosolic fractions, respectively. f , Western blot of nuclear N2ICD in WT and Rubcn −/− BMDMs with or without 1 μM CytoD treatment for 3 h upon efferocytosis. g , Confocal microscopy imaging of WT and Rubcn −/− RAW264.7 cells expressing Notch1–mCherry–NLS reporter and TIM4. Cells were cultured with unconjugated (control) beads or beads conjugated with DLL1 ± biotinylated PS for 3 h before fixing and imaging. Activation of Notch1 receptor was quantified by the intensity of mCherry in the nucleus over the total for each cell (100 × nuclear/total). Control group: WT, n = 21; Rubcn − / − , n = 25. DLL1 group: WT, n = 33; Rubcn − / − , n = 20. DLL + PS group: WT, n = 28; Rubcn − / − , n = 52. Statistical analysis was conducted using a Student’s t -test. Scale bars, 10 μm. h , WT RAW264.7 cells expressing Notch1–mCherry–NLS reporter and TIM4 were cultured with the indicated beads for 3 h before fixing and imaging. For RAW264.7 cells incubated with a mixture of beads coupled with DLL1 plus PS (no color) and DLL1 alone (green), cells that had engulfed or were in close contact with both were quantified as described above. Control, n = 33; DLL1, n = 38; DLL1 + PS, n = 34; DLL1 + PS and DLL1, n = 30; DAPT, n = 28. Asterisks indicate engulfed beads. Data are the mean ± s.d. Dots represent single cells. Statistical analysis was conducted using a Student’s t -test. Scale bars, 10 μm. GSEA significance was calculated using one-sided permutation testing based on a preranked approach. Panels created in BioRender: a , Verbist, K. https://biorender.com/jsrbskx (2026); c , Verbist, K. https://bioRender.com/q7evtdr (2026).

    Article Snippet: Mouse Notch1 (amino acids 1–1770) was cloned from Notch1 full-length plasmid (Addgene, 41728) followed by mCherry–NLS or mNeongreen–NLS (synthesized by Integrated DNA Technologies (IDT)) and inserted into pMXs retrovirus vector.

    Techniques: Cell Culture, Incubation, Sequencing, Expressing, Injection, Isolation, RNA Sequencing, Western Blot, Binding Assay, Confocal Microscopy, Imaging, Control, Activation Assay

    ( a ) Schematic showing the design of the Notch1-mCherry-NLS reporter. Murine Notch1 is cleaved at amino acid 1744 by γ -secretase. To make the Notch activation reporter, murine Notch1 (1-1770aa) was fused to mCherry with a C-terminal nuclear localization sequence (NLS), so the activation of Notch induces the translocation of cleaved mCherry to the nucleus. ( b ) Immunoblot of Notch1-mCherry-NLS expression in WT and Rubicon-deficient Raw264.7 cells with anti-mCherry antibody. ( c ) Confocal microscopy image of murine Notch1 (1744-1770aa)-mCherry-NLS fusion protein stably expressed in RAW264.7 cells. DIC, differential interference contrast. ( d ) Confocal microscopy imaging of WT and Rubcn −/− RAW264.7 cells expressing Notch1-mCherry-NS reporter. Cells were cultured with unconjugated (control) beads or beads conjugated with DLL1±biotin-mouse IgG1 Fc for 3 hours before fixing and imaging. Activation of Notch1 receptor was quantified by the intensity of mCherry in the nucleus over total for each cell (100 x nuclear/total). Control group: WT(n = 38), Rubcn − / − (n = 24); DLL1 group: WT(n = 50), Rubcn − / − (n = 38); DLL+IgG group: WT(n = 51), Rubcn − / − (n = 32). Results of two independent experiments were combined. *indicates engulfed beads. Each dot represents a single cell. Data are mean±s.d. Student’s t test. Scale bars, 10 μm. Illustrations in a created in BioRender; Verbist, K. https://biorender.com/4yjlad1 (2026).

    Journal: Nature Immunology

    Article Title: Exclusion of Notch from the contact site during efferocytosis restricts anticancer immunity

    doi: 10.1038/s41590-026-02452-3

    Figure Lengend Snippet: ( a ) Schematic showing the design of the Notch1-mCherry-NLS reporter. Murine Notch1 is cleaved at amino acid 1744 by γ -secretase. To make the Notch activation reporter, murine Notch1 (1-1770aa) was fused to mCherry with a C-terminal nuclear localization sequence (NLS), so the activation of Notch induces the translocation of cleaved mCherry to the nucleus. ( b ) Immunoblot of Notch1-mCherry-NLS expression in WT and Rubicon-deficient Raw264.7 cells with anti-mCherry antibody. ( c ) Confocal microscopy image of murine Notch1 (1744-1770aa)-mCherry-NLS fusion protein stably expressed in RAW264.7 cells. DIC, differential interference contrast. ( d ) Confocal microscopy imaging of WT and Rubcn −/− RAW264.7 cells expressing Notch1-mCherry-NS reporter. Cells were cultured with unconjugated (control) beads or beads conjugated with DLL1±biotin-mouse IgG1 Fc for 3 hours before fixing and imaging. Activation of Notch1 receptor was quantified by the intensity of mCherry in the nucleus over total for each cell (100 x nuclear/total). Control group: WT(n = 38), Rubcn − / − (n = 24); DLL1 group: WT(n = 50), Rubcn − / − (n = 38); DLL+IgG group: WT(n = 51), Rubcn − / − (n = 32). Results of two independent experiments were combined. *indicates engulfed beads. Each dot represents a single cell. Data are mean±s.d. Student’s t test. Scale bars, 10 μm. Illustrations in a created in BioRender; Verbist, K. https://biorender.com/4yjlad1 (2026).

    Article Snippet: Mouse Notch1 (amino acids 1–1770) was cloned from Notch1 full-length plasmid (Addgene, 41728) followed by mCherry–NLS or mNeongreen–NLS (synthesized by Integrated DNA Technologies (IDT)) and inserted into pMXs retrovirus vector.

    Techniques: Activation Assay, Sequencing, Translocation Assay, Western Blot, Expressing, Confocal Microscopy, Stable Transfection, Imaging, Cell Culture, Control, Single Cell

    a , b , Representative TIRF images ( a ) and quantification ( b ) of Notch1–mNeongreen (green) exclusion from areas with IgG Fc (red) in WT ( n = 30), Rubcn −/− ( n = 26) and ATG5 −/− ( n = 20) THP-1 cells. c , THP-1 cells expressing Notch1–mNeongreen were pretreated with Fc blocker and anti-CD32 antibody for 30 min before seeding on arrayed human IgG Fc and cultured for 10 min. Notch1 exclusion was quantified as described in the . Results of two independent experiments were combined. WT, n = 19; Rubcn −/− , n = 16; WT + FcR blocker, n = 27. d , Quantification of Notch1 exclusion in WT and Rubcn −/− THP-1 cells with or without Flag-tagged murine Rubcn. WT, n = 18; Rubcn −/− , n = 20; Rubcn −/− with Flag–mRubcn, n = 19. e , f , TIRF imaging of Notch1 exclusion in Dox-treated WT ( n = 19) or shVPS34 ( n = 30) expressing THP-1 cells ( e ) or ATG14 −/− THP-1 cells ( n = 19) ( f ). g , h , Representative TIRF images ( g ) and quantification ( h ) of Notch–mNeongreen (green) exclusion from contact sites of PS-containing RBC membranes (red) in WT ( n = 22) and Rubcn −/− ( n = 21) THP-1 cells. Results of two independent experiments were combined. Quantification was assessed as (1 − ( X − B / Y − B )] × 100, where X is the MFI of green over red dots, Y is the MFI of green dots over whole cells and B is the MFI of green dots over background. Each point represents a single cell. Scale bars, 10 μm. Data are the mean ± s.d. Statistical analysis was conducted using a Student’s t -test ( b – f , h ).

    Journal: Nature Immunology

    Article Title: Exclusion of Notch from the contact site during efferocytosis restricts anticancer immunity

    doi: 10.1038/s41590-026-02452-3

    Figure Lengend Snippet: a , b , Representative TIRF images ( a ) and quantification ( b ) of Notch1–mNeongreen (green) exclusion from areas with IgG Fc (red) in WT ( n = 30), Rubcn −/− ( n = 26) and ATG5 −/− ( n = 20) THP-1 cells. c , THP-1 cells expressing Notch1–mNeongreen were pretreated with Fc blocker and anti-CD32 antibody for 30 min before seeding on arrayed human IgG Fc and cultured for 10 min. Notch1 exclusion was quantified as described in the . Results of two independent experiments were combined. WT, n = 19; Rubcn −/− , n = 16; WT + FcR blocker, n = 27. d , Quantification of Notch1 exclusion in WT and Rubcn −/− THP-1 cells with or without Flag-tagged murine Rubcn. WT, n = 18; Rubcn −/− , n = 20; Rubcn −/− with Flag–mRubcn, n = 19. e , f , TIRF imaging of Notch1 exclusion in Dox-treated WT ( n = 19) or shVPS34 ( n = 30) expressing THP-1 cells ( e ) or ATG14 −/− THP-1 cells ( n = 19) ( f ). g , h , Representative TIRF images ( g ) and quantification ( h ) of Notch–mNeongreen (green) exclusion from contact sites of PS-containing RBC membranes (red) in WT ( n = 22) and Rubcn −/− ( n = 21) THP-1 cells. Results of two independent experiments were combined. Quantification was assessed as (1 − ( X − B / Y − B )] × 100, where X is the MFI of green over red dots, Y is the MFI of green dots over whole cells and B is the MFI of green dots over background. Each point represents a single cell. Scale bars, 10 μm. Data are the mean ± s.d. Statistical analysis was conducted using a Student’s t -test ( b – f , h ).

    Article Snippet: Mouse Notch1 (amino acids 1–1770) was cloned from Notch1 full-length plasmid (Addgene, 41728) followed by mCherry–NLS or mNeongreen–NLS (synthesized by Integrated DNA Technologies (IDT)) and inserted into pMXs retrovirus vector.

    Techniques: Expressing, Cell Culture, Imaging, Single Cell

    ( a ) Western blot of Rubicon in parental and THP-1 cells stably expressing Cas9 and sgRNA targeting Rubicon. Cells treated with or without 20 ng/ml PMA for 16 hours were lysed for western blot. ( b ) Western blot of ATG5 in parental and THP-1 cells stably expressing Cas9 and sgRNA targeting Atg5 for ablation. ( c ) Representative images for Fig. . THP-1 cells expressing Notch1-mNeongreen were pretreated with Fc blocker and anti-CD32 antibody for 30 mins before seeding on micropatterned human IgG and cultured for 10 mins at 37 °C. ( d ) TIRF images of Raw264.7 cells stably expressing the indicated fusion proteins and quantification of enrichment of Flag-mCherry (n = 16) and mCherry-Rubicon (n = 25) on mouse IgG contact regions. Data are mean±s.d. Student’s t test. ( e ) Immunoblot of Rubicon in parental and THP-1 cells with ablation of endogenous Rubicon as shown in ( a ) with or without expression of Flag tagged murine Rubicon (Flag-mRubcn). ( f ) THP-1 cells stably expressing Flag-mCherry or mCherry-tagged murine Rubicon (mCherry-mRubcn) were lysed and subjected to RFP-TRAP-immunoprecipitation (IP) and immunoblotted. 10% of total lysates served as input for IP. ( g ) Representative TIRF images of Notch1 exclusion in WT or Rubcn −/− THP-1 cells with or without Flag-tagged murine Rubicon as in Fig. . ( h ) Western blot of VPS34 and ATG14 in parental THP-1 cells and THP-1 cells expressing shVPS34 or sgRNAs targeting Atg14 . ( i ) TIRF images and quantification of Notch exclusion in shVPS34 THP-1 cells with or without Dox treatment to induce the expression of shRNA against Vps34 . Results of two independent experiments were combined. No dox group (n = 22), Dox group (n = 27). Data are mean±s.d. Student’s t test. ( j ) Representative images of Fig. . TIRF images of Notch1-mNeongreen in WT and Atg14 −/− THP-1 cells cultured on human IgG dots. Each dot represents a single cell. Scale bars, 10 μm.

    Journal: Nature Immunology

    Article Title: Exclusion of Notch from the contact site during efferocytosis restricts anticancer immunity

    doi: 10.1038/s41590-026-02452-3

    Figure Lengend Snippet: ( a ) Western blot of Rubicon in parental and THP-1 cells stably expressing Cas9 and sgRNA targeting Rubicon. Cells treated with or without 20 ng/ml PMA for 16 hours were lysed for western blot. ( b ) Western blot of ATG5 in parental and THP-1 cells stably expressing Cas9 and sgRNA targeting Atg5 for ablation. ( c ) Representative images for Fig. . THP-1 cells expressing Notch1-mNeongreen were pretreated with Fc blocker and anti-CD32 antibody for 30 mins before seeding on micropatterned human IgG and cultured for 10 mins at 37 °C. ( d ) TIRF images of Raw264.7 cells stably expressing the indicated fusion proteins and quantification of enrichment of Flag-mCherry (n = 16) and mCherry-Rubicon (n = 25) on mouse IgG contact regions. Data are mean±s.d. Student’s t test. ( e ) Immunoblot of Rubicon in parental and THP-1 cells with ablation of endogenous Rubicon as shown in ( a ) with or without expression of Flag tagged murine Rubicon (Flag-mRubcn). ( f ) THP-1 cells stably expressing Flag-mCherry or mCherry-tagged murine Rubicon (mCherry-mRubcn) were lysed and subjected to RFP-TRAP-immunoprecipitation (IP) and immunoblotted. 10% of total lysates served as input for IP. ( g ) Representative TIRF images of Notch1 exclusion in WT or Rubcn −/− THP-1 cells with or without Flag-tagged murine Rubicon as in Fig. . ( h ) Western blot of VPS34 and ATG14 in parental THP-1 cells and THP-1 cells expressing shVPS34 or sgRNAs targeting Atg14 . ( i ) TIRF images and quantification of Notch exclusion in shVPS34 THP-1 cells with or without Dox treatment to induce the expression of shRNA against Vps34 . Results of two independent experiments were combined. No dox group (n = 22), Dox group (n = 27). Data are mean±s.d. Student’s t test. ( j ) Representative images of Fig. . TIRF images of Notch1-mNeongreen in WT and Atg14 −/− THP-1 cells cultured on human IgG dots. Each dot represents a single cell. Scale bars, 10 μm.

    Article Snippet: Mouse Notch1 (amino acids 1–1770) was cloned from Notch1 full-length plasmid (Addgene, 41728) followed by mCherry–NLS or mNeongreen–NLS (synthesized by Integrated DNA Technologies (IDT)) and inserted into pMXs retrovirus vector.

    Techniques: Western Blot, Stable Transfection, Expressing, Cell Culture, Immunoprecipitation, shRNA, Single Cell

    a , TIRF imaging of WT ( n = 36) and Rubcn −/− ( n = 20) THP-1 cells expressing mNeongreen–PLD1 cultured on micropatterned human IgG for 10 min. b , Representative TIRF images (left) and quantification (right) of active β2 integrin staining in WT ( n = 33) and PLD1 −/− ( n = 43) THP-1 cells cultured on arrayed human IgG dots. c , TIRF imaging of Notch exclusion. THP-1 cells were pretreated with 15 μg ml −1 PLD1 inhibitor VU0359595 for 20 h and seeded on micropatterned human IgG for 10 min. Results of two independent experiments were combined. Control, n = 17; PLD inhibitor, n = 25. Scale bars, 10 μm. d , Schematic of experimental design. WT BMDMs were cultured with apoptotic Jurkat cells in the presence of DMSO or 10 μg ml −1 PLD1 inhibitor VU0359595 and 2.5 μg ml −1 PLD2 inhibitor VU0364739 hydrochloride for 3 h. ACs were then washed off before RNA extraction for RNA-seq. e , f , GSEA of upregulated Notch1 target genes ( e ) and Hallmark genes of inflammatory response ( f ) in WT BMDMs treated with DMSO or PLD inhibitors during efferocytosis as in d . Data are the mean ± s.d. Statistical analysis was conducted using a Student’s t -test ( a – c ). Scale bars, 10 μm. GSEA significance was calculated using one-sided permutation testing based on a preranked approach. Illustrations in d were created in BioRender; Verbist, K. https://biorender.com/j30t950 (2026).

    Journal: Nature Immunology

    Article Title: Exclusion of Notch from the contact site during efferocytosis restricts anticancer immunity

    doi: 10.1038/s41590-026-02452-3

    Figure Lengend Snippet: a , TIRF imaging of WT ( n = 36) and Rubcn −/− ( n = 20) THP-1 cells expressing mNeongreen–PLD1 cultured on micropatterned human IgG for 10 min. b , Representative TIRF images (left) and quantification (right) of active β2 integrin staining in WT ( n = 33) and PLD1 −/− ( n = 43) THP-1 cells cultured on arrayed human IgG dots. c , TIRF imaging of Notch exclusion. THP-1 cells were pretreated with 15 μg ml −1 PLD1 inhibitor VU0359595 for 20 h and seeded on micropatterned human IgG for 10 min. Results of two independent experiments were combined. Control, n = 17; PLD inhibitor, n = 25. Scale bars, 10 μm. d , Schematic of experimental design. WT BMDMs were cultured with apoptotic Jurkat cells in the presence of DMSO or 10 μg ml −1 PLD1 inhibitor VU0359595 and 2.5 μg ml −1 PLD2 inhibitor VU0364739 hydrochloride for 3 h. ACs were then washed off before RNA extraction for RNA-seq. e , f , GSEA of upregulated Notch1 target genes ( e ) and Hallmark genes of inflammatory response ( f ) in WT BMDMs treated with DMSO or PLD inhibitors during efferocytosis as in d . Data are the mean ± s.d. Statistical analysis was conducted using a Student’s t -test ( a – c ). Scale bars, 10 μm. GSEA significance was calculated using one-sided permutation testing based on a preranked approach. Illustrations in d were created in BioRender; Verbist, K. https://biorender.com/j30t950 (2026).

    Article Snippet: Mouse Notch1 (amino acids 1–1770) was cloned from Notch1 full-length plasmid (Addgene, 41728) followed by mCherry–NLS or mNeongreen–NLS (synthesized by Integrated DNA Technologies (IDT)) and inserted into pMXs retrovirus vector.

    Techniques: Imaging, Expressing, Cell Culture, Staining, Control, RNA Extraction, RNA Sequencing

    ( a and b ) Quantification of the percentage of nuclear mCherry in Hoxb8 BMDM expressing Notch1-mCherry-NLS reporter. Hoxb8 BMDM were treated with DMSO or 1 μg/ml PLD1 inhibitor, VU035959, combined with 1 μg/ml PLD2 inhibitor, VU0364739, for 3 hours before co-culturing with apoptotic parental and DLL1-expressing CHO-K1 cells ( a ) or co-culturing with live or apoptotic DLL1-expressing CHO-K1 cells ( b ). Activation of Notch1 receptor was quantified by the intensity of mCherry in the nucleus over total for each cell (100 x nuclear/total). Data are mean ± s.d. Each dot represents a single cell. ( c ) WT BMDM were treated with DMSO or 2.5 μg/ml, 5 μg/ml or 10 μg/ml PLD1 inhibitor, VU0359595, for 17 hours then co-cultured with apoptotic Jurkat cells expressing tdTomato in the presence of DMSO or the same concentration of PLD1 inhibitor plus PLD2 inhibitor, VU0364739 (2.5 μg/ml), for 3 hours. Efferocytosis was determined by flow cytometry. Data analysis is from three independent experiments and are presented as mean±s.e.m. Student’s t test was used in all analyses.

    Journal: Nature Immunology

    Article Title: Exclusion of Notch from the contact site during efferocytosis restricts anticancer immunity

    doi: 10.1038/s41590-026-02452-3

    Figure Lengend Snippet: ( a and b ) Quantification of the percentage of nuclear mCherry in Hoxb8 BMDM expressing Notch1-mCherry-NLS reporter. Hoxb8 BMDM were treated with DMSO or 1 μg/ml PLD1 inhibitor, VU035959, combined with 1 μg/ml PLD2 inhibitor, VU0364739, for 3 hours before co-culturing with apoptotic parental and DLL1-expressing CHO-K1 cells ( a ) or co-culturing with live or apoptotic DLL1-expressing CHO-K1 cells ( b ). Activation of Notch1 receptor was quantified by the intensity of mCherry in the nucleus over total for each cell (100 x nuclear/total). Data are mean ± s.d. Each dot represents a single cell. ( c ) WT BMDM were treated with DMSO or 2.5 μg/ml, 5 μg/ml or 10 μg/ml PLD1 inhibitor, VU0359595, for 17 hours then co-cultured with apoptotic Jurkat cells expressing tdTomato in the presence of DMSO or the same concentration of PLD1 inhibitor plus PLD2 inhibitor, VU0364739 (2.5 μg/ml), for 3 hours. Efferocytosis was determined by flow cytometry. Data analysis is from three independent experiments and are presented as mean±s.e.m. Student’s t test was used in all analyses.

    Article Snippet: Mouse Notch1 (amino acids 1–1770) was cloned from Notch1 full-length plasmid (Addgene, 41728) followed by mCherry–NLS or mNeongreen–NLS (synthesized by Integrated DNA Technologies (IDT)) and inserted into pMXs retrovirus vector.

    Techniques: Expressing, Activation Assay, Single Cell, Cell Culture, Concentration Assay, Flow Cytometry